CH05b06, CH05b06 (genetic_marker) Malus x domestica

Marker Overview
NameCH05b06
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1CH05b06.forward: CAC GAC GTT GTA AAA CGA CACA AGC AAA CCT AAT ACC ACC G
Primer 2CH05b06.primer 1: ACAAGCAAACCTAATACCACCG
Primer 3CH05b06.primer 2: GAGACTGGAAGAGTTGCAGAGG
Primer 4CH05b06.reverse: GAG ACT GGA AGA GTT GCA GAG G
Product Length138-226
PolymorphismP_ CH05b06
Publication[view all]
ContactC. Gessler
CommentGenomic DNA was extracted from leaf tissue using Qiagen DNeasy 96 plant kits (QIAGEN GmbH, Hilden Germany). Sixteen SSR primers were selected for amplification based on previously published studies (Table 2; Liebhard et al. 2002; Yamamoto et al. 2002). The M13 primer, 5’ CACGACGTTGTAAAACGA 3’, with fluorescent dye label (6FAM, or VIC, or NED) was covalently bound to the 5’ end for detection on the ABI 3730 was synthetized from Applied Biosystems (Carlsbad, CA). The two unlabeled primers consisted of a specific SSR-targeting forward primer with a 5’ M13 tail and a specific SSR-targeting reverse primer was synthetized from Sangon Biotech (Shanghai, China). Amplification was carried out in two PCR cycles. The first PCR amplification was performed in a 10μl solution of 20 ng genomic DNA, 1×PCR buffer, 0.25 mM dNTP, 0.6 unit Taq DNA polymerase, 2 mM MgCl2, 0.24μM reverse primer, 0.24 μM forward primer with M13 tail. The first PCR amplification was performed under the following conditions: 94℃ (5 min), 35 cycles at 94℃(30 s)/annealing temperature (An.T) (30 s)/72℃ (45 s), and a final extension at 72℃ for 10 min. using the optimal annealing temperature for each locus (Table 2). The second amplification reaction was performed in a 12.1μl solution of 10μl PCR products of the first PCR circle, 0.3μM fluorescent labeled M13 primer, 0.1× supplied PCR buffer, 0.4 unit of Taq DNA polymerase. The conditions of the second PCR amplification were as follows: 94℃ (5 min), 16 cycles at 94℃ (30 s)/53℃(45 s)/72℃ (45 s), and a final extension at 72℃for10 min. The PCR products were cleaned with ethanol, and then denaturated at 94℃ for 5 min. Finally the fluorescent labeled PCR products at each locus were separated using an ABI 3730 DNA Analyzer (Applied Biosystems, Carlsbad, CA).
Contact
NameDetails
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:Switzerland
Email:cesare.gessler@agrl.ethz.ch
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1CH05b06.primer 1Malus x domesticaprimer
primer 2CH05b06.primer 2Malus x domesticaprimer
forwardCH05b06.forwardMalus x domesticaprimer
reverseCH05b06.reverseMalus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CH05b06zCH05b06zMalus x domesticamarker_locus
CH05b06yCH05b06yMalus x domesticamarker_locus
CH05b06xCH05b06xMalus x domesticamarker_locus
CH05b06uCH05b06uMalus x domesticamarker_locus
CH05b06wCH05b06wMalus x domesticamarker_locus
CH05b06vCH05b06vMalus x domesticamarker_locus
CH05b06.xCH05b06.xMalus x domesticamarker_locus
CH05b06CH05b06Malus x domesticamarker_locus
CH05b06CH05b06-14.8Malus x domesticamarker_locus
CH05b06CH05b06-4.3Malus x domesticamarker_locus
CH05b06CH05b06-1.7Malus x domesticamarker_locus
CH05b06CH05b06-2.6Malus x domesticamarker_locus
CH05b06CH05b06-3.4Malus x domesticamarker_locus
CH05b06CH05b06-2.5Malus x domesticamarker_locus
CH05b06.wCH05b06.wMalus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map5N/A5.6CH05b06zView
2Apple-FD-F1-2006D5N/A7.7CH05b06zView
3Apple-FD-F1-2006F5N/A6.8CH05b06zView
4Apple-FD-F1-2006F16N/A15.7CH05b06yView
5Apple Integrated map10N/A3.4CH05b06yView
6Apple-IM-F1-IdaredIda LG 16N/A0CH05b06yView
7Apple-IM-F1-Mr5Mr5 LG 16N/A0CH05b06yView
8Apple-FD-F1-2006F16N/A4.1CH05b06xView
9Apple-IM-F1-Mr5Mr5 LG 17N/A22.1CH05b06uView
10Apple-MAL0045_x_Idared-F1-MfuscaLG17N/A0.2CH05b06uView
11Apple-MAL0045_x_Idared-F1-MfuscaLG3N/A54.4CH05b06wView
12Apple-IM-F1-Mr5Mr5 LG 7N/A14.9CH05b06vView
13Apple-MAL0045_x_Idared-F1-MfuscaLG7aN/A0CH05b06vView
14Apple-MM-F110N/A4.1CH05b06.xView
15Apple-M432-2012LG10N/A0CH05b06.xView
16Apple-X3259X3263-F110N/A0CH05b06View
17Apple-JM7xS63-F1S16N/A0CH05b06View
18Apple-JM7xS63-F1J17N/A2.5CH05b06View
19Apple-JM7xS63-F1J5N/A14.8CH05b06View
20Apple-JM7xS63-F1S5N/A4.3CH05b06View
21Apple-JM7xS63-F1J15N/A1.7CH05b06View
22Apple-JM7xS63-F1S15N/A2.6CH05b06View
23Apple-JM7xS63-F1J16N/A3.4CH05b06View
24Apple-JM7xS63-F1J17N/A2.5CH05b06View
25Apple-M432-2012LG3N/A55.1CH05b06.wView