CH05c02, CH05c02 (genetic_marker) Malus x domestica

Marker Overview
NameCH05c02
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1CH05c02.primer 1: TTAAACTGTCACCAAATCCACA
Primer 2CH05c02.primer 2: GCGAAGCTTTAGAGAGACATCC
Product Length168-200
PolymorphismP_ CH05c02
Publication[view all]
ContactC. Gessler
Zhen Han
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1CH05c02.primer 1Malus x domesticaprimer
primer 2CH05c02.primer 2Malus x domesticaprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fruit lengthqFRL.JGD-G11.2008Malus x domesticaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CH05c02CH05c02Malus x domesticamarker_locus
CH05c02CH05c02-30Malus x domesticamarker_locus
CH05c02CH05c02-32.1Malus x domesticamarker_locus
CH05c02CH05c02-98.7Malus x domesticamarker_locus
CH05c02CH05c02-98.837Malus x domesticamarker_locus
CH05c02CH05c02-109.103Malus x domesticamarker_locus
CH05c02CH05c02-82.45Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-MM-F111N/A48.6CH05c02View
2Apple-JGD-F1-BotcankerG11N/A55CH05c02View
3Apple-GDxJ-F1-2012LG11N/A52.5CH05c02View
4Apple-M432-2012LG11N/A53.6CH05c02View
5Apple-JGD-F1-2014J11N/A19.6CH05c02View
6Apple-JGD-F1-2014G11N/A15.8CH05c02View
7Apple-M27xM116-2016LG11N/A47.6CH05c02View
8Pear-BD-F1-2014-geneticLG11N/A67CH05c02View
9Apple-JM7xS63-F1J11N/A30CH05c02View
10Pear-Ba-F1-2013Ba11N/A32.1CH05c02View
11Pear-BD-F1-2015LG11N/A98.7CH05c02View
12Pear-Bayuehong-F1-2015LG11N/A98.84CH05c02View
13Pear-Dangshansuli-F1-2015LG11N/A109.1CH05c02View
14Pear-integrated_consensus_map-IPCG-2017LG11N/A82.45CH05c02View
Contact
NameDetails
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:Switzerland
Email:cesare.gessler@agrl.ethz.ch
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002
Zhen Han
First name:Zhen
Last name:Han
Institution:Institute for Horticultural Plants, China Agricultural University
Address:Beijing 100193, China
Country:China
Email:rschan@cau.edu.cn
Keywords:apple