CH05g07, CH05g07 (genetic_marker) Malus x domestica

Marker Overview


Name	CH05g07
Genbank ID	N/A
Type	SSR
Species	Malus x domestica
Repeat Motif	GA
PCR Condition	annealing temp 60 degree
Primer 1	CH05g07.primer 1: CCCAAGCAATATAGTGAATCTCAA
Primer 2	CH05g07.primer 2: TTCATCTCCTGCTGCAAATAAC
Product Length	149-197
Polymorphism	P_ CH05g07
Publication	[view all]
Contact	C. Gessler Andreas Peil R. Liebhard

Contact

Name

Details

C. Gessler

First name:	Cesare
Last name:	Gessler
Institution:	ETH Zurich
Address:	ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:	Switzerland
Email:	cesare.gessler@agrl.ethz.ch
Phone:	+41 44 632 38 71
Fax:	+41 (0) 632 11 08
Last update:	May 2002

Andreas Peil

First name:	Andreas
Last name:	Peil
Title:	Researcher
Institution:	Institute for Breeding Research on Fruit
Address:	Kulius Kuhn-Institut (JKI), Pillnitzer Platz 3a, 01326
Country:	Dresden, Germany
Email:	andreas.peil@jki.bund.de

R. Liebhard

First name:	R.
Last name:	Liebhard
Institution:	Swiss Federal Institute of Technology
Address:	Swiss Federal Institute of Technology, Institute of Plant Science / Phytopathology, Universitätstrasse 2, 8092 Zurich, Switzerland
Country:	Switzerland

Publications


Year	Publication
2009	Celton J-M, Tustin DS, Chagne D, Gardiner SE. Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009; 5(1):93-107.
2002	Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2014	Wöhner TW, Flachowsky H, Richter K, Garcia-Libreros T, Trognitz F, Hanke M, Peil A. QTL mapping of fire blight resistance in Malus ×robusta 5 after inoculation with different strains of Erwinia amylovora. Molecular breeding. 2014; 34(1):217-230.
2014	Emeriewen O, Richter K, Kilian A, Zini E, Hanke M, Malnoy M, Peil A. Identification of a major quantitative trait locus for resistance to fire blight in the wild apple species Malus fusca. Molecular breeding. 2014; 34(2):407-419.
2012	Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2015	Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2004	Plant Breeding, 123(4):321

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Apple-FD-F1-2006	D12	N/A	30.9	CH05g07y	View
2	Apple-FD-F1-2006	F12	N/A	31.5	CH05g07y	View
3	Apple Integrated map	12	N/A	18.2	CH05g07y	View
4	Apple-IM-F1-Idared	Ida LG 12	N/A	19.3	CH05g07y	View
5	Apple-IM-F1-Mr5	Mr5 LG 12	N/A	14.7	CH05g07y	View
6	Apple-RGxPI6-F1	LG14	N/A	24	CH05g07y	View
7	Apple Integrated map	14	N/A	14.6	CH05g07z	View
8	Apple-FD-F1-2006	F14	N/A	8.2	CH05g07z	View
9	Apple-FD-F1-2006	D14a	N/A	8	CH05g07z	View
10	Apple-IM-F1-Mr5	Mr5 LG 14	N/A	14.6	CH05g07z	View
11	Apple-FD-Discovery-F1-2003	D14	N/A	8.1	CH05g07z	View
12	Apple-IM-F1-Idared	Ida LG 14	N/A	17.8	CH05g07	View
13	Apple-MAL0045_x_Idared-F1-Mfusca	LG14	N/A	27.7	CH05g07	View
14	Apple-X3259X3263-F1	12	N/A	20.02	CH05g07	View
15	Apple-X3259X3263-F1	14	N/A	15.75	CH05g07	View
16	Apple-X5210X8402-F1-Consensus	LG14	N/A	13.8	CH05g07	View
17	Apple-X5210X8402-F1-X5210	LG14	N/A	24.6	CH05g07	View
18	Apple-X5210X8402-F1-X8402	LG14	N/A	0	CH05g07	View
19	Apple-JGxWSH-F1	LG12	N/A	11.5	CH05g07	View
20	Apple-WSH-F1	LG12	N/A	8	CH05g07	View
21	Pear-BD-F1-2014-genetic	LG14	N/A	18.8	CH05g07	View
22	Pear-Bartlett-F1-2007	Ba12	N/A	13.7	CH05g07	View
23	Pear-Bartlett-F1-2007	Ba14	N/A	15.5	CH05g07	View
24	Pear-La_France-F1-2007	La12	N/A	19	CH05g07	View
25	Pear-La_France-F1-2007	La14	N/A	11.4	CH05g07	View
26	Apple-MM-F1	12	N/A	13.4	CH05g07.y	View
27	Apple-M432-2012	LG12	N/A	14.7	CH05g07.y	View
28	Apple-MM-F1	14	N/A	20.6	CH05g07.z	View
29	Apple-M432-2012	LG14	N/A	2	CH05g07.z	View
30	Pear-Ba-F1-2013	Ba12	N/A	13	CH05g07	View
31	Pear-Ba-F1-2013	Ba14	N/A	15.2	CH05g07	View
32	Pear-BD-F1-2015	LG14	N/A	37.1	CH05g07	View
33	Pear-Bayuehong-F1-2015	LG14	N/A	40.7	CH05g07	View
34	Pear-Dangshansuli-F1-2015	LG14	N/A	40.24	CH05g07	View
35	Pear-integrated_consensus_map-IPCG-2017	LG12	N/A	108.39	CH05g07	View
36	Pear-integrated_consensus_map-IPCG-2017	LG14	N/A	44.25	CH05g07	View