Hi01c04, Hi01c04 (genetic_marker) Malus x domestica | GDR

Marker Overview

Marker Overview


Name	Hi01c04
Genbank ID	N/A
Type	SSR
Species	Malus x domestica
Repeat Motif	GA
PCR Condition	annealing temp 60 degree
Primer 1	Hi01c04.primer 1: GCTGCCGTTGACGTTAGAG
Primer 2	Hi01c04.primer 2: GTTTGTAGAAGTGGCGTTTGAGG
Product Length	214-232
Polymorphism	P_ Hi01c04
Publication	[view all]
Contact	A. Patocchi E. Silfverberg-Dilworth Fabrizio Costa

Contact

Name

Details

A. Patocchi

First name:	Andrea
Last name:	Patocchi
Institution:	Agroscope Changins-W?denswil Research Station ACW
Address:	Standort W?denswil Schloss Postfach 185 8820 W?denswil
Country:	SWITZERLAND
Email:	andrea.patocchi@acw.admin.ch
Phone:	+41 44 783 6313
Fax:	+41 (0)44 783 63 05

E. Silfverberg-Dilworth

First name:	E.
Last name:	Silfverberg-Dilworth
Institution:	Swiss Federal Institute of Technology
Address:	Plant Pathology, Institute of Plant Science, Swiss Federal Institute of Technology, ETH Zurich, Switzerland
Country:	Switzerland

Fabrizio Costa

First name:	Fabrizio
Last name:	Costa
Title:	Researcher
Institution:	Research and Innovation Centre, Foundation Edmund Mach
Address:	Via Mach 1, I-38010 San Michele all’Adige, Trento, Italy
Country:	Italy
Email:	fabrizio.costa@iasma.it
Phone:	390461615358
Fax:	390461650956

Publications


Year	Publication
2006	Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2013	Di Guardo M, Tadiello A, Farneti B, Lorenz G, Masuero D, Vrhovsek U, Costa G, Velasco R, Costa F. A Multidisciplinary Approach Providing New Insight into Fruit Flesh Browning Physiology in Apple (Malus x domestica Borkh.). PloS one. 2013; 8(10):e78004.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Apple-FD-F1-2006	D5	N/A	19.5	Hi01c04	View
2	Apple-RGxPI6-F1	LG5	N/A	15.8	Hi01c04	View
3	Apple-JGxWSH-F1	LG5	N/A	0	Hi01c04	View
4	Apple-WSH-F1	LG5	N/A	0	Hi01c04	View
5	Apple-FD-F1-2006	F5	N/A	13.1	Hi01c04p	View
6	Pear-Rcf-F1-female	LG5	N/A	7.53	Hi01c04	View
7	Pear-M-F1-male	LG5	N/A	22.28	Hi01c04	View
8	Pear-RM-F1-Integrated	LG5	N/A	20.95	Hi01c04	View
9	Apple-JM7xS63-F1	J5	N/A	25.4	Hi01c04p	View
10	Apple-FjxPL-F1-2013	LG5	N/A	10.63	Hi01C04_A	View
11	Apple-FjxPL-F1-2013	LG5	N/A	18.91	Hi01C04_B	View