|
|
Marker Overview
| Name | Hi01d05 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Malus x domestica |
|---|
| Repeat Motif | GA |
|---|
| PCR Condition | annealing temp 60 degree |
|---|
| Primer 1 | Hi01d05.primer 1: GGTATCCTCTTCATCGCCTG |
|---|
| Primer 2 | Hi01d05.primer 2: TTAGATTGACGTTCCGACCC |
|---|
| Product Length | 210->330 |
|---|
| Polymorphism | P_ Hi01d05 |
|---|
| Publication | [view all] |
|---|
| Contact | A. Patocchi
|
|---|
Publications
| Year | Publication |
|---|
| 2006 | Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224. |
| 2012 | Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203. |
|
