Hi02g06, Hi02g06 (genetic_marker) Malus x domestica

Marker Overview
NameHi02g06
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1Hi02g06.primer 1: AGATAGGTTTCACCGTCTCAGC
Primer 2Hi02g06.primer 2: GACCTCTTTGGTGCGTCTG
Product Length149-163
PolymorphismP_ Hi02g06
Publication[view all]
ContactA. Patocchi
Contact
NameDetails
A. Patocchi
First name:Andrea
Last name:Patocchi
Institution:Agroscope Changins-W?denswil Research Station ACW
Address:Standort W?denswil Schloss Postfach 185 8820 W?denswil
Country:SWITZERLAND
Email:andrea.patocchi@acw.admin.ch
Phone:+41 44 783 6313
Fax:+41 (0)44 783 63 05
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1Hi02g06.primer 1Malus x domesticaprimer
primer 2Hi02g06.primer 2Malus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Hi02g06Hi02g06Malus x domesticamarker_locus
Hi02g06Hi02g06-6Malus x domesticamarker_locus
Hi02g06Hi02g06-6.9Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-FD-F1-2006D15N/A15.6Hi02g06View
2Apple-FjxPL-F1-2013LG15N/A37.84Hi02g06View
3Apple-JM7xS63-F1J15N/A6Hi02g06View
4Apple-JM7xS63-F1S15N/A6.9Hi02g06View