Hi03a03, Hi03a03 (genetic_marker) Malus x domestica

Marker Overview
NameHi03a03
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1Hi03a03.primer 1: ACACTTCCGGATTTCTGCTC
Primer 2Hi03a03.primer 2: GTTTGTTGCTGTTGGATTATGCC
Product Length160-228
PolymorphismP_ Hi03a03
Publication[view all]
ContactA. Patocchi
Andreas Peil
Miyuki Kunihisa
Contact
NameDetails
A. Patocchi
First name:Andrea
Last name:Patocchi
Institution:Agroscope Changins-W?denswil Research Station ACW
Address:Standort W?denswil Schloss Postfach 185 8820 W?denswil
Country:SWITZERLAND
Email:andrea.patocchi@acw.admin.ch
Phone:+41 44 783 6313
Fax:+41 (0)44 783 63 05
Andreas Peil
First name:Andreas
Last name:Peil
Title:Researcher
Institution:Institute for Breeding Research on Fruit
Address:Kulius Kuhn-Institut (JKI), Pillnitzer Platz 3a, 01326
Country:Dresden, Germany
Email:andreas.peil@jki.bund.de
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1Hi03a03.primer 1Malus x domesticaprimer
primer 2Hi03a03.primer 2Malus x domesticaprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
resistance to Erwinia amylovoraqREA.IM-Mr5-ch14Malus robustaQTL
resistance to Erwinia amylovoraqREA.IM-Mr5-ch14.2Malus robustaQTL
resistance to Erwinia amylovoraqREA.IM-Mr5-ch14.1Malus robustaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Hi03a03Hi03a03Malus x domesticamarker_locus
Hi03a03Hi03a03-3.984Malus x domesticamarker_locus
Hi03a03Hi03a03-51Malus x domesticamarker_locus
Hi03a03Hi03a03-58.7Malus x domesticamarker_locus
Hi03a03Hi03a03-50.9Malus x domesticamarker_locus
Hi03a03Hi03a03-47.1Malus x domesticamarker_locus
Hi03a03Hi03a03-54.4Malus x domesticamarker_locus
Hi03a03-m2Hi03a03-m2-48.2Malus x domesticamarker_locus
Hi03a03Hi03a03-155.52Malus x domesticamarker_locus
Hi03a03Hi03a03-181.03Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-FD-F1-2006F6N/A68.6Hi03a03View
2Apple-FD-F1-2006D6N/A78.9Hi03a03View
3Apple-IM-F1-Mr5Mr5 LG 6N/A67.6Hi03a03View
4Apple-OA-F1-OrinOR6N/A46.4Hi03a03View
5Apple-OA-F1-AkaneAK6N/A63.4Hi03a03View
6Pear-Rcf-F1-femaleLG14N/A0Hi03a03View
7Pear-RM-F1-IntegratedLG14N/A3.98Hi03a03View
8Apple-JM7xS63-F1J6N/A51Hi03a03View
9Apple-JM7xS63-F1S6N/A58.7Hi03a03View
10Apple-JM7xS63-F1J14N/A50.9Hi03a03View
11Apple-JM7xS63-F1S14N/A47.1Hi03a03View
12Pear-Ba-F1-2013Ba6N/A54.4Hi03a03View
13Pear-Ba-F1-2013Ba14N/A48.2Hi03a03-m2View
14Pear-integrated_consensus_map-IPCG-2017LG6N/A155.52Hi03a03View
15Pear-integrated_consensus_map-IPCG-2017LG14N/A181.03Hi03a03View