|
|
Marker Overview
| Name | Hi07b06 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Malus x domestica |
|---|
| Repeat Motif | GT |
|---|
| PCR Condition | annealing temp 60 degree |
|---|
| Primer 1 | Hi07b06.primer 1: AGCTGCAGGTAGAGTTCCAAG |
|---|
| Primer 2 | Hi07b06.primer 2: GTTTCATTACCATTACACGTACAGC |
|---|
| Product Length | 220-226 |
|---|
| Polymorphism | P_ Hi07b06 |
|---|
| Publication | [view all] |
|---|
| Contact | A. Patocchi
Miyuki Kunihisa
|
|---|
Publications
| Year | Publication |
|---|
| 2006 | Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224. |
| 2012 | Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203. |
| 2014 | Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51. |
| 2015 | Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119 |
| 2002 | Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241. |
| 2004 | Plant Breeding, 123(4):321 |
|
