Hi07d12, Hi07d12 (genetic_marker) Malus x domestica

Marker Overview
NameHi07d12
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGT
PCR Conditionannealing temp 60 degree
Primer 1Hi07d12.primer 1: GGAATGAGGGAGAAGGAAGTG
Primer 2Hi07d12.primer 2: GTTTCCTCTTCACGTGGGATGTACC
Product Length184-250
PolymorphismP_ Hi07d12
Publication[view all]
ContactA. Patocchi
Contact
NameDetails
A. Patocchi
First name:Andrea
Last name:Patocchi
Institution:Agroscope Changins-W?denswil Research Station ACW
Address:Standort W?denswil Schloss Postfach 185 8820 W?denswil
Country:SWITZERLAND
Email:andrea.patocchi@acw.admin.ch
Phone:+41 44 783 6313
Fax:+41 (0)44 783 63 05
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1Hi07d12.primer 1Malus x domesticaprimer
primer 2Hi07d12.primer 2Malus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Hi07d12Hi07d12Malus x domesticamarker_locus
Hi07d12xHi07d12xMalus x domesticamarker_locus
Hi07d12Hi07d12-40Malus x domesticamarker_locus
Hi07d12Hi07d12-32.7Malus x domesticamarker_locus
Hi07d12Hi07d12-47.7Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-FD-F1-2006D2N/A26.7Hi07d12View
2Apple-FD-F1-2006F7N/A3.7Hi07d12xView
3Apple-IM-F1-Mr5Mr5 LG 7N/A14Hi07d12xView
4Apple-JM7xS63-F1J2N/A40Hi07d12View
5Apple-JM7xS63-F1S2N/A32.7Hi07d12View
6Apple-JM7xS63-F1S16N/A47.7Hi07d12View