|
Marker Overview
Name | Hi08f05 |
Genbank ID | N/A |
Type | SSR |
Species | Malus x domestica |
Repeat Motif | AAG |
PCR Condition | annealing temp 60 degree |
Primer 1 | Hi08f05.primer 1: GTGTGGGCGATTCTAACTGC |
Primer 2 | Hi08f05.primer 2: GTTTCCTTTATTCTAAACATGCCACGTC |
Product Length | 165-165 |
Polymorphism | P_ Hi08f05 |
Publication | [view all] |
Contact | A. Patocchi
|
Publications
Year | Publication |
2009 | Celton J-M, Tustin DS, Chagne D, Gardiner SE. Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009; 5(1):93-107. |
2006 | Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224. |
|