Hi08g03, Hi08g03 (genetic_marker) Malus x domestica

Marker Overview
Genbank IDN/A
SpeciesMalus x domestica
Repeat MotifAAG
PCR Conditionannealing temp 60 degree
Primer 1Hi08g03.primer 1: ATTCACTTCCACCGCCATAG
Product Length104-116
PolymorphismP_ Hi08g03
Publication[view all]
ContactA. Patocchi
Andreas Peil
Miyuki Kunihisa
Zhen Han

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1Hi08g03.primer 1Malus x domesticaprimer
primer 2Hi08g03.primer 2Malus x domesticaprimer

This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
resistance to Botryosphaeria dothideaqRBD.JGD-chG10.2008Malus x domesticaQTL

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Hi08g03Hi08g03Malus x domesticamarker_locus

Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
2Apple-IM-F1-IdaredIda LG 6N/A38.6Hi08g03View
3Apple-IM-F1-Mr5Mr5 LG 6N/A38.4Hi08g03View
A. Patocchi
First name:Andrea
Last name:Patocchi
Institution:Agroscope Changins-W?denswil Research Station ACW
Address:Standort W?denswil Schloss Postfach 185 8820 W?denswil
Phone:+41 44 783 6313
Fax:+41 (0)44 783 63 05
Andreas Peil
First name:Andreas
Last name:Peil
Institution:Institute for Breeding Research on Fruit
Address:Kulius Kuhn-Institut (JKI), Pillnitzer Platz 3a, 01326
Country:Dresden, Germany
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Keywords:fruit drop
Zhen Han
First name:Zhen
Last name:Han
Institution:Institute for Horticultural Plants, China Agricultural University
Address:Beijing 100193, China