Hi08g12, Hi08g12 (genetic_marker) Malus x domestica

Marker Overview
NameHi08g12
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifAAG
PCR Conditionannealing temp 60 degree
Primer 1Hi08g12.primer 1: AGTTCGGTCGGTTCCGTAAT
Primer 2Hi08g12.primer 2: GTTTAGGGCAAGGGGAAAGAAGT
Product Length188-197
PolymorphismP_ Hi08g12
Publication[view all]
ContactA. Patocchi
Zhen Han
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1Hi08g12.primer 1Malus x domesticaprimer
primer 2Hi08g12.primer 2Malus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Hi08g12Hi08g12Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-FD-F1-2006D2N/A6.5Hi08g12View
2Apple-JGD-F1-FRRG2N/A13.7Hi08g12View
3Apple-RGxPI6-F1LG2N/A1.3Hi08g12View
Contact
NameDetails
A. Patocchi
First name:Andrea
Last name:Patocchi
Institution:Agroscope Changins-W?denswil Research Station ACW
Address:Standort W?denswil Schloss Postfach 185 8820 W?denswil
Country:SWITZERLAND
Email:andrea.patocchi@acw.admin.ch
Phone:+41 44 783 6313
Fax:+41 (0)44 783 63 05
Zhen Han
First name:Zhen
Last name:Han
Institution:Institute for Horticultural Plants, China Agricultural University
Address:Beijing 100193, China
Country:China
Email:rschan@cau.edu.cn
Keywords:apple