|
Marker Overview
Name | Hi08g12 |
Genbank ID | N/A |
Type | SSR |
Species | Malus x domestica |
Repeat Motif | AAG |
PCR Condition | annealing temp 60 degree |
Primer 1 | Hi08g12.primer 1: AGTTCGGTCGGTTCCGTAAT |
Primer 2 | Hi08g12.primer 2: GTTTAGGGCAAGGGGAAAGAAGT |
Product Length | 188-197 |
Polymorphism | P_ Hi08g12 |
Publication | [view all] |
Contact | A. Patocchi Zhen Han
|
Publications
Year | Publication |
2006 | Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224. |
2015 | Cui MS, Yang LL, Han YY, Zhang Q, Zhao YB, Li CM, Han YP, Wang Y, Chen DM, Yang FQ, Zhang XZ, Han ZH. Genetic mapping reveals sophisticated responses of Malus domestica to Botryosphaeria dothidea isolates. Journal of Phytopathology. 2015; 163:42–53. |
|