|
Marker Overview
Name | Hi23d02 |
Genbank ID | N/A |
Type | SSR |
Species | Malus x domestica |
Repeat Motif | CTT |
PCR Condition | annealing temp 60 degree |
Primer 1 | Hi23d02.primer 1: CCGGCATATCAAAGTCTTCC |
Primer 2 | Hi23d02.primer 2: GTTTGATGGTCTGAGGCAATGGAG |
Product Length | 157-166 |
Polymorphism | P_ Hi23d02 |
Publication | [view all] |
Contact | A. Patocchi
|
Publications
Year | Publication |
2006 | Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224. |
Relationships
This genetic_marker is adjacent to the following primer feature(s):
This genetic_marker is adjacent to the following QTL feature(s):
The following marker_locus feature(s) are an instance of this genetic_marker:
|