Hi23d11, Hi23d11 (genetic_marker) Malus x domestica

Marker Overview
NameHi23d11
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifCTT
PCR Conditionannealing temp 60 degree
Primer 1Hi23d11.primer 1: GACAGCCAGAAGAACCCAAC
Primer 2Hi23d11.primer 2: GTTTATTGGTCCATTTCCCAGGAG
Product Length177-184
PolymorphismP_ Hi23d11
Publication[view all]
ContactA. Patocchi
Contact
NameDetails
A. Patocchi
First name:Andrea
Last name:Patocchi
Institution:Agroscope Changins-W?denswil Research Station ACW
Address:Standort W?denswil Schloss Postfach 185 8820 W?denswil
Country:SWITZERLAND
Email:andrea.patocchi@acw.admin.ch
Phone:+41 44 783 6313
Fax:+41 (0)44 783 63 05
Publications
YearPublication
2009Celton J-M, Tustin DS, Chagne D, Gardiner SE. Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009; 5(1):93-107.
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-ME-F1E12N/A54.2Hi23d11View
2Apple-FD-F1-2006F4N/A65Hi23d11View
3Apple Integrated map4N/A60.6Hi23d11View
4Apple-FD-F1-2006D4N/A75.7Hi23d11View
5Apple-MM-F14N/A67.3Hi23d11View
6Apple-GDxJ-F1-2012LG4N/A59.8Hi23d11View
7Apple-M432-2012LG4N/A66.2Hi23d11View
8Apple-JGD-F1-2014G4N/A45.5Hi23d11View
9Pear-AN-F1LG4N/A70.8Hi23d11View
Alignments
Feature NameTypeLocationAnalysis
Chr04 chromosome Chr04:30925653..30925831. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr4A chromosome chr4A:29318747..29318922. Malus x domestica ‘Honeycrisp’ Genome v1.1.a1 Assembly & Annotation