|
|
Marker Overview
| Name | Hi23g02 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Malus x domestica |
|---|
| Repeat Motif | AAC |
|---|
| PCR Condition | annealing temp 60 degree |
|---|
| Primer 1 | Hi23g02.primer 1: TTTTCCAGGATATACTACCCTTCC |
|---|
| Primer 2 | Hi23g02.primer 2: GTTTCTTCGAGGTCAGGGTTTG |
|---|
| Product Length | 230-257 |
|---|
| Polymorphism | P_ Hi23g02 |
|---|
| Publication | [view all] |
|---|
| Contact | A. Patocchi
|
|---|
Publications
| Year | Publication |
|---|
| 2010 | Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839. |
| 2006 | Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224. |
| 2015 | Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119 |
| 2002 | Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241. |
| 2004 | Plant Breeding, 123(4):321 |
|
