Md-Exp7, Md-Exp7 (genetic_marker) Malus x domestica

Marker Overview
NameMd-Exp7
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifCT
PCR Conditionone cycle at 94°C for 150 s, 32 cycles at 60°C for 45 s, 72°C for 60 s and 94°C for 30 s, one last cycle at 60°C for for 10 min 45 s and 72°C
Primer 1Md-Exp7.forward primer: CATAGAAGGTGGCATGAGCA
Primer 2Md-Exp7.reverse primer: TTTCTCCTCACACCCAAACC
Product Length198-214
Max Length208 bp
PolymorphismP_ Md-Exp7
Publication[view all]
ContactFabrizio Costa
Commentalso found in Pyrus communis
Contact
NameDetails
Fabrizio Costa
First name:Fabrizio
Last name:Costa
Title:Researcher
Institution:Research and Innovation Centre, Foundation Edmund Mach
Address:Via Mach 1, I-38010 San Michele all’Adige, Trento, Italy
Country:Italy
Email:fabrizio.costa@iasma.it
Phone:390461615358
Fax:390461650956
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
reverse primerMd-Exp7.reverse primerMalus x domesticaprimer
forward primerMd-Exp7.forward primerMalus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Md-Exp7Md-Exp7Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pear-PM-F1-Moonglow1N/A40.45Md-Exp7View
2Pear-AP3480-F1P3480-LG1N/A44.2Md-Exp7View