|
Marker Overview
Name | Md-Exp7 |
Genbank ID | N/A |
Type | SSR |
Species | Malus x domestica |
Repeat Motif | CT |
PCR Condition | one cycle at 94°C for 150 s, 32 cycles at 60°C for 45 s, 72°C for 60 s and 94°C for 30 s, one last cycle at 60°C for for 10 min 45 s and 72°C |
Primer 1 | Md-Exp7.forward primer: CATAGAAGGTGGCATGAGCA |
Primer 2 | Md-Exp7.reverse primer: TTTCTCCTCACACCCAAACC |
Product Length | 198-214 |
Max Length | 208 bp |
Polymorphism | P_ Md-Exp7 |
Publication | [view all] |
Contact | Fabrizio Costa
|
Comment | also found in Pyrus communis |
|