s1_42397607, s1_42397607 (genetic_marker) Prunus avium

Marker Overview
Names1_42397607
dbSNP IDN/A
SNP Array ID
Cherry 6+9K SNP array:s1_42397607
TypeSNP
SNP AllelesA/G
5' Flanking SequenceCAGCAGT
3' Flanking SequenceCAGACTCCAAAAACGAAATCGCTTGAGAAGTCAGACCTCTTTACTTCCAATTCTTC
SpeciesPrunus avium
Publication[view all]
ContactPatricio Hinrichsen
Stijn Vanderzande
Commentsweet cherry SNPs identified by GBS from Guajardo et al (2015), genetically mapped
Contact
NameDetails
Patricio Hinrichsen
First name:Patricio
Last name:Hinrichsen
Title:Investigator, R&D SubDirector
Institution:Instituto de Investigaciones Agropecuarias (INIA) La Platina
Address:Santa Rosa 11610, La Pintana
Country:Chile
Email:phinrichsen@inia.cl
Phone:56 2 25779101
Fax:56 2 25779104
Keywords:Plant genetics and breeding
Stijn Vanderzande
First name:Stijn
Last name:Vanderzande
Address:Laboratory for Fruit Breeding and Biotechnology - Willem de Croylaan 42 - B-3001 Heverlee - Belgium
Country:Belgium
Email:stijn.vanderzande@wsu.edu
Libraries
Library NameType
Cherry 6+9K SNP arraySNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Sweet Cherry-Ra-F1RaLG1N/A138.13s1_42397607View
2Sweet Cherry-RaxRi-F1LG1N/A124.97s1_42397607View
3Sweet_cherry_RaxRi_F1-physical-Prunus-persicaV1.0scaffold 1N/A42397607s1_42397607View
4Sweet Cherry-RosBREED-3.8K-20201N/A140.8s1_42397607View
Sequence
>s1_42397607 ID=s1_42397607; Name=s1_42397607; organism=Prunus avium; type=genetic_marker; length=64bp
CAGCAGTRCAGACTCCAAAAACGAAATCGCTTGAGAAGTCAGACCTCTTT
ACTTCCAATTCTTC
Alignments
Feature NameTypeLocationAnalysis
Pp01 chromosome Pp01:47418399..47418399. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
PAV_r1.0chr1 chromosome PAV_r1.0chr1:38845958..38845958. Prunus avium Whole Genome Assembly v1.0 & Annotation v1 (v1.0.a1)