s2_25362470, s2_25362470 (genetic_marker) Prunus avium

Marker Overview
Names2_25362470
dbSNP IDN/A
SNP Array ID
Cherry 6+9K SNP array:s2_25362470
TypeSNP
SNP AllelesA/G
5' Flanking SequenceATGGATGCTTGGATGAGGTGGTTGGGATGGGGGACATCGTCAGCTGCGCGACGAATTCGG AGGTGCCTCTTGTGAAGGGGAAGACGCTGAAGGCAGGGGCGCACTTGGACTTGGTTGGAT CTTTCAAGCACTCAATGAAGGAGTGTGATG
3' Flanking SequenceCGAGGCGATAAGGAGAGGGAGAGTGTTTGTTGATAATGAGGCTGCGTTGGTGGAGGCAGG GGAGCTGGTGGGTGCGTTTGAGAGAGGGGTGATTGGGAAGGCAGATGTTTGTGGGATGCT GGTAGAGTTGATCAAAGAAGACAAGGCTGG
SpeciesPrunus avium
Publication[view all]
ContactPatricio Hinrichsen
Stijn Vanderzande
Commentsweet cherry SNPs identified by GBS from Guajardo et al (2015), genetically mapped
Contact
NameDetails
Patricio Hinrichsen
First name:Patricio
Last name:Hinrichsen
Title:Investigator, R&D SubDirector
Institution:Instituto de Investigaciones Agropecuarias (INIA) La Platina
Address:Santa Rosa 11610, La Pintana
Country:Chile
Email:phinrichsen@inia.cl
Phone:56 2 25779101
Fax:56 2 25779104
Keywords:Plant genetics and breeding
Stijn Vanderzande
First name:Stijn
Last name:Vanderzande
Address:Laboratory for Fruit Breeding and Biotechnology - Willem de Croylaan 42 - B-3001 Heverlee - Belgium
Country:Belgium
Email:stijn.vanderzande@wsu.edu
Libraries
Library NameType
Cherry 6+9K SNP arraySNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
s2_25362470s2_25362470Prunus aviummarker_locus


Sequence
>s2_25362470 ID=s2_25362470|Name=s2_25362470|organism=Prunus avium|type=genetic_marker|length=301bp
ATGGATGCTTGGATGAGGTGGTTGGGATGGGGGACATCGTCAGCTGCGCG
ACGAATTCGGAGGTGCCTCTTGTGAAGGGGAAGACGCTGAAGGCAGGGGC
GCACTTGGACTTGGTTGGATCTTTCAAGCACTCAATGAAGGAGTGTGATG
RCGAGGCGATAAGGAGAGGGAGAGTGTTTGTTGATAATGAGGCTGCGTTG
GTGGAGGCAGGGGAGCTGGTGGGTGCGTTTGAGAGAGGGGTGATTGGGAA
GGCAGATGTTTGTGGGATGCTGGTAGAGTTGATCAAAGAAGACAAGGCTG
G
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Sweet Cherry-RaxRi-F1LG2N/A75.31s2_25362470View
2Sweet_cherry_RaxRi_F1-physical-Prunus-persicaV1.0scaffold 2N/A25362470s2_25362470View
Alignments
Feature NameTypeLocationAnalysis
Pp02 chromosome Pp02:28959800..28959800. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
PAV_r1.0chr2 chromosome PAV_r1.0chr2:23731133..23731133. Prunus avium Whole Genome Assembly v1.0 & Annotation v1 (v1.0.a1)