s3_19894677, s3_19894677 (genetic_marker) Prunus avium

Marker Overview
Names3_19894677
dbSNP IDN/A
SNP Array ID
Cherry 6+9K SNP array:s3_19894677
TypeSNP
SNP AllelesT/C
5' Flanking SequenceCAGCCATGCTCGTTACTCAGATAGTTGTGTTACAGAGCTTAATCTGGTACAATATGTTA
3' Flanking SequenceTGTT
SpeciesPrunus avium
Publication[view all]
ContactPatricio Hinrichsen
Stijn Vanderzande
Commentsweet cherry SNPs identified by GBS from Guajardo et al (2015), genetically mapped
Contact
NameDetails
Patricio Hinrichsen
First name:Patricio
Last name:Hinrichsen
Title:Investigator, R&D SubDirector
Institution:Instituto de Investigaciones Agropecuarias (INIA) La Platina
Address:Santa Rosa 11610, La Pintana
Country:Chile
Email:phinrichsen@inia.cl
Phone:56 2 25779101
Fax:56 2 25779104
Keywords:Plant genetics and breeding
Stijn Vanderzande
First name:Stijn
Last name:Vanderzande
Address:Laboratory for Fruit Breeding and Biotechnology - Willem de Croylaan 42 - B-3001 Heverlee - Belgium
Country:Belgium
Email:stijn.vanderzande@wsu.edu
Libraries
Library NameType
Cherry 6+9K SNP arraySNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
s3_19894677s3_19894677Prunus aviummarker_locus


Sequence
>s3_19894677 ID=s3_19894677|Name=s3_19894677|organism=Prunus avium|type=genetic_marker|length=64bp
CAGCCATGCTCGTTACTCAGATAGTTGTGTTACAGAGCTTAATCTGGTAC
AATATGTTAYTGTT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Sweet Cherry-Ri-F1RiLG3N/A69.97s3_19894677View
2Sweet Cherry-RaxRi-F1LG3N/A80.15s3_19894677View
3Sweet_cherry_RaxRi_F1-physical-Prunus-persicaV1.0scaffold 3N/A19894677s3_19894677View
4Sweet Cherry-RosBREED-3.8K-20203N/A74.12s3_19894677View
5Sweet Cherry-V-F1-6+9K_array3N/A50.87s3_19894677View
6Sweet Cherry-VxC-F1-6+9K_array3N/A86.67s3_19894677View
Alignments
Feature NameTypeLocationAnalysis
Pp03 chromosome Pp03:25237140..25237140. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
PAV_r1.0chr3 chromosome PAV_r1.0chr3:19726454..19726454. Prunus avium Whole Genome Assembly v1.0 & Annotation v1 (v1.0.a1)