s5_11883742, s5_11883742 (genetic_marker) Prunus avium

Marker Overview
Names5_11883742
dbSNP IDN/A
SNP Array ID
Cherry 6+9K SNP array:s5_11883742
TypeSNP
SNP AllelesA/G
5' Flanking SequenceCAGCCAAGGAGGGCTCATCGGGCCAGAAGGTTTCTGAGATTGCTGGCTTTCTGA
3' Flanking SequenceAGGAGGTCA
SpeciesPrunus avium
Publication[view all]
ContactPatricio Hinrichsen
Stijn Vanderzande
Commentsweet cherry SNPs identified by GBS from Guajardo et al (2015), genetically mapped
Contact
NameDetails
Patricio Hinrichsen
First name:Patricio
Last name:Hinrichsen
Title:Investigator, R&D SubDirector
Institution:Instituto de Investigaciones Agropecuarias (INIA) La Platina
Address:Santa Rosa 11610, La Pintana
Country:Chile
Email:phinrichsen@inia.cl
Phone:56 2 25779101
Fax:56 2 25779104
Keywords:Plant genetics and breeding
Stijn Vanderzande
First name:Stijn
Last name:Vanderzande
Address:Laboratory for Fruit Breeding and Biotechnology - Willem de Croylaan 42 - B-3001 Heverlee - Belgium
Country:Belgium
Email:stijn.vanderzande@wsu.edu
Libraries
Library NameType
Cherry 6+9K SNP arraySNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
s5_11883742s5_11883742Prunus aviummarker_locus


Sequence
>s5_11883742 ID=s5_11883742|Name=s5_11883742|organism=Prunus avium|type=genetic_marker|length=64bp
CAGCCAAGGAGGGCTCATCGGGCCAGAAGGTTTCTGAGATTGCTGGCTTT
CTGARAGGAGGTCA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Sweet Cherry-RaxRi-F1LG5N/A37.44s5_11883742View
2Sweet_cherry_RaxRi_F1-physical-Prunus-persicaV1.0scaffold 5N/A11883742s5_11883742View
3Sweet Cherry-RosBREED-3.8K-20205N/A30.63s5_11883742View
4Sweet Cherry-V-F1-6+9K_array5N/A39.62s5_11883742View
5Sweet Cherry-VxC-F1-6+9K_array5N/A44.57s5_11883742View
Alignments
Feature NameTypeLocationAnalysis
Pp05 chromosome Pp05:11878749..11878749. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
PAV_r1.0chr5 chromosome PAV_r1.0chr5:9480663..9480663. Prunus avium Whole Genome Assembly v1.0 & Annotation v1 (v1.0.a1)