s5_15005383, s5_15005383 (genetic_marker) Prunus avium

Marker Overview
Names5_15005383
dbSNP IDN/A
SNP Array ID
Cherry 6+9K SNP array:s5_15005383
TypeSNP
SNP AllelesA/G
5' Flanking SequenceCAGCCCAAAAACTCAGCAGGTATGTATCAACTGGTATTTATATTCTCATAACGCTAGTGA ATC
SpeciesPrunus avium
Publication[view all]
ContactPatricio Hinrichsen
Stijn Vanderzande
Commentsweet cherry SNPs identified by GBS from Guajardo et al (2015), genetically mapped
Contact
NameDetails
Patricio Hinrichsen
First name:Patricio
Last name:Hinrichsen
Title:Investigator, R&D SubDirector
Institution:Instituto de Investigaciones Agropecuarias (INIA) La Platina
Address:Santa Rosa 11610, La Pintana
Country:Chile
Email:phinrichsen@inia.cl
Phone:56 2 25779101
Fax:56 2 25779104
Keywords:Plant genetics and breeding
Stijn Vanderzande
First name:Stijn
Last name:Vanderzande
Address:Laboratory for Fruit Breeding and Biotechnology - Willem de Croylaan 42 - B-3001 Heverlee - Belgium
Country:Belgium
Email:stijn.vanderzande@wsu.edu
Libraries
Library NameType
Cherry 6+9K SNP arraySNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
s5_15005383s5_15005383Prunus aviummarker_locus


Sequence
>s5_15005383 ID=s5_15005383|Name=s5_15005383|organism=Prunus avium|type=genetic_marker|length=64bp
CAGCCCAAAAACTCAGCAGGTATGTATCAACTGGTATTTATATTCTCATA
ACGCTAGTGAATCR
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Sweet Cherry-Ri-F1RiLG5N/A41.41s5_15005383View
2Sweet Cherry-RaxRi-F1LG5N/A56.87s5_15005383View
3Sweet_cherry_RaxRi_F1-physical-Prunus-persicaV1.0scaffold 5N/A15005383s5_15005383View
4Sweet Cherry-RosBREED-3.8K-20205N/A46.39s5_15005383View
5Sweet Cherry-V-F1-6+9K_array5N/A53.18s5_15005383View
6Sweet Cherry-VxC-F1-6+9K_array5N/A59.68s5_15005383View
Alignments
Feature NameTypeLocationAnalysis
Pp05 chromosome Pp05:15000031..15000031. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)