s8_21416042, s8_21416042 (genetic_marker) Prunus avium

Marker Overview
Names8_21416042
dbSNP IDN/A
SNP Array ID
Cherry 6+9K SNP array:s8_21416042
TypeSNP
SNP AllelesA/G
5' Flanking SequenceATCGGTTCGACCCTGAGCTGTGATGGCATTGAATTGGCCACTCATTGGCAGCCTGGGATA TAAGTTGCAATTTTGGAAAACAACTGCAGCATTTCCAAATATGAAGTCTACCGTGCCATA GATGTCGCATTCTCTATAGAATTGCCTCAG
3' Flanking SequenceGAATGCGTGTATAAGGTGTCTTGGTACGCTTCGAAGCTGCAGCTATAGAATGTGGACAGA TCAGCACCGTTTCGAACTGCAACCGCTTGGTGCTTGATTGCTCCCGCAGTGTTACGGAAG GTCATGTTCACTGCTACAAATCCAGGTGCA
SpeciesPrunus avium
Publication[view all]
ContactPatricio Hinrichsen
Stijn Vanderzande
Commentsweet cherry SNPs identified by GBS from Guajardo et al (2015), genetically mapped
Contact
NameDetails
Patricio Hinrichsen
First name:Patricio
Last name:Hinrichsen
Title:Investigator, R&D SubDirector
Institution:Instituto de Investigaciones Agropecuarias (INIA) La Platina
Address:Santa Rosa 11610, La Pintana
Country:Chile
Email:phinrichsen@inia.cl
Phone:56 2 25779101
Fax:56 2 25779104
Keywords:Plant genetics and breeding
Stijn Vanderzande
First name:Stijn
Last name:Vanderzande
Address:Laboratory for Fruit Breeding and Biotechnology - Willem de Croylaan 42 - B-3001 Heverlee - Belgium
Country:Belgium
Email:stijn.vanderzande@wsu.edu
Libraries
Library NameType
Cherry 6+9K SNP arraySNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Sweet Cherry-Ra-F1RaLG8N/A66.75s8_21416042View
2Sweet Cherry-RaxRi-F1LG8N/A67.42s8_21416042View
3Sweet_cherry_RaxRi_F1-physical-Prunus-persicaV1.0scaffold 8N/A21416042s8_21416042View
4Sweet Cherry-RosBREED-3.8K-20208N/A67.31s8_21416042View
Sequence
>s8_21416042 ID=s8_21416042; Name=s8_21416042; organism=Prunus avium; type=genetic_marker; length=301bp
ATCGGTTCGACCCTGAGCTGTGATGGCATTGAATTGGCCACTCATTGGCA
GCCTGGGATATAAGTTGCAATTTTGGAAAACAACTGCAGCATTTCCAAAT
ATGAAGTCTACCGTGCCATAGATGTCGCATTCTCTATAGAATTGCCTCAG
RGAATGCGTGTATAAGGTGTCTTGGTACGCTTCGAAGCTGCAGCTATAGA
ATGTGGACAGATCAGCACCGTTTCGAACTGCAACCGCTTGGTGCTTGATT
GCTCCCGCAGTGTTACGGAAGGTCATGTTCACTGCTACAAATCCAGGTGC
A