UDAp-415, UDAp-415 (genetic_marker) Prunus armeniaca

Marker Overview
NameUDAp-415
Genbank IDBV102511
TypeSSR
SpeciesPrunus armeniaca
GermplasmPortici
Source Typegenomic DNA
Repeat Motif(GA)21
PCR Condition95 C 2 min, 94 C 20 sec, 56 C 20 sec, 65 C 40 sec. 25 cycles, 65 C 7 min
Primer 1UDAp-415.F primer: AACTGATGAGAAGGGGCTTG
Primer 2UDAp-415.Forward Primer: AACTGATGAGAAGGGGCTTG
Primer 3UDAp-415.R primer: ACTCCCGACATTTGTGCTTC
Primer 4UDAp-415.Reverse Primer: ACTCCCGACATTTGTGCTTC
Product Length156bp
Publication[view all]
ContactR. Testolin
Maria Badenes
Contact
NameDetails
R. Testolin
First name:Raffaele
Last name:Testolin
Institution:University of Udine, Italy
Address:Dipartimento di Scienze Agrarie e Ambientali University of Udine Via delle Scienze 208 I-33100 Udine, Italy
Country:Italy
Email:raffaele.testolin@uniud.it
Phone:0432 558632
Maria Badenes
First name:Maria 
Last name:Badenes
Institution:Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:Spain
Email:badenes_mlu@gva.es
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
R primerUDAp-415.R primerPrunus armeniacaprimer
F primerUDAp-415.F primerPrunus armeniacaprimer
R primerUDAp-415.R primerPrunus amygdalusprimer
F primerUDAp-415.F primerPrunus amygdalusprimer
Forward PrimerUDAp-415.Forward PrimerPrunus armeniacaprimer
Reverse PrimerUDAp-415.Reverse PrimerPrunus armeniacaprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
total water soluble contentqSSC.HAxRM-ch1Prunus armeniacaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
UDAp-415UDAp-415Prunus armeniacamarker_locus
UDAp415UDAp415Prunus armeniacamarker_locus


Germplasm
Stock NameType
Porticicultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apricot-HAxRM-F1G1N/A17.3UDAp-415View
2Apricot-LB-F1B1N/A0UDAp-415View
3Sweet Cherry-Ra-F1RaLG1N/A14.45UDAp-415View
4Sweet Cherry-Ri-F1RiLG1N/A19.47UDAp-415View
5Sweet Cherry-RaxRi-F1LG1N/A28.54UDAp-415View
6Apricot-integrated-Goldrich-2011LG1N/A15.1UDAp-415View
7Apricot-BC-F1-2016B1N/A21.1UDAp-415View
8Apricot-GC-F1-2016G1N/A10.9UDAp-415View
9Apricot-BC-F1-2016-PhenologyB1N/A33.4UDAp415View
10Apricot-GC-F1-2016-PhenologyG1N/A9.3UDAp415View