SNP_FB_0411240, SNP_FB_0411240 (genetic_marker) Malus x domestica

Marker Overview
NameSNP_FB_0411240
AliasF_0411240_L1_PA
dbSNP ID.
SNP Array ID
480K SNP array for apple:SNP_FB_0411240
20K SNP array for apple:SNP_FB_0411240
TypeSNP
SNP AllelesT/G
Probe 1SNP_FB_0411240.probe: ATCTGCTATCATGACATCAAAGGGTTTTGTATATTGTAGTGGCCACCCTA
5' Flanking SequenceCTTTGCCTCCATCTGCTATCATGACATCAAAGGGTTTTGTATATTGTAGTGGCCACCCTA
3' Flanking SequenceCTCCTCCAATGACCTACAATCTATAAAATTATGTGTACTACCCGAGTCTAACAAAATCTT
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Libraries
Library NameType
20K SNP array for appleSNP_chip
480K SNP array for appleSNP_chip
Relationships

The following probe feature(s) are associated with this genetic_marker:

Feature NameUnique NameSpeciesType
probeSNP_FB_0411240.probeMalus x domesticaprobe


Sequence
>SNP_FB_0411240 ID=SNP_FB_0411240|Name=SNP_FB_0411240|organism=Malus x domestica|type=genetic_marker|length=75bp
ATCAAAGGGTTTTGTATATTGTAGTGGCCACCCTA[G/T]CTCCTCCAAT
GACCTACAATCTATAAAATTATGTG
Alignments
Feature NameTypeLocationAnalysis
Chr01 chromosome Chr01:5581289..5581289- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation