SNP_FB_0497574, SNP_FB_0497574 (genetic_marker) Malus x domestica

Marker Overview
NameSNP_FB_0497574
dbSNP ID.
SNP Array ID
480K SNP array for apple:AX-115192953
20K SNP array for apple:SNP_FB_0497574
TypeSNP
SNP AllelesT/G
Probe 1SNP_FB_0497574.probe: TCTAGAGAAGTTCAAGCAATCAATATTTAGCTCAATTGACTAAAAAAATG
5' Flanking SequenceTTTTTTTTGCTATTAGTATTGAGATTGGNTTCTTCCTCACCTTGTCGATGAAGAGAAAGA
3' Flanking SequenceCATTTTTTTAGTCAATTGAGCTAAATATTGATTGCTTGAACTTCTCTAGATATATAACTG
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Libraries
Library NameType
20K SNP array for appleSNP_chip
480K SNP array for appleSNP_chip
Alignments
The following features are aligned
Feature Name Type LocationAnalysisReference
Chr01chromosomeChr01:21247946..21247946 +Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotationn/a
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-RGTxGD-F1-2015GD_1N/A24.71SNP_FB_0497574View
Sequence
>SNP_FB_0497574 ID=SNP_FB_0497574; Name=SNP_FB_0497574; organism=Malus x domestica; type=genetic_marker; length=71bp
TTCTTCCTCACCTTGTCGATGAAGAGAAAGA[A/C]CATTTTTTTAGTCA
ATTGAGCTAAATATTGATTGC