NH021a, NH021a (genetic_marker) Pyrus pyrifolia | GDR

Marker Overview

Marker Overview


Name	NH021a
Genbank ID	N/A
Type	SSR
Species	Pyrus pyrifolia
Repeat Motif	(AG)21
Primer 1	NH021a.forward primer: atctcaattttctcggtaacca
Primer 2	NH021a.reverse primer: ctgatatctctctgcactccct
Max Length	168 bp
Publication	[view all]
Contact	Toshiya Yamamoto Miyuki Kunihisa

Contact

Name

Details

Toshiya Yamamoto

First name:	Toshiya
Last name:	Yamamoto
Institution:	National Institute of Fruit Tree Science, Graduate School of Life and Environmental Sciences, University of Tsukuba
Address:	National Institute of Fruit Tree Science, 2-1 Fujimoto, Tsukuba, Ibaraki 305-8605, Japan
Country:	Japan
Email:	toshiya@affrc.go.jp
Last update:	Apr 2014

Miyuki Kunihisa

First name:	Miyuki
Last name:	Kunihisa
Institution:	NARO Institute of Fruit Tree Science
Address:	2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:	Japan
Email:	miyuky@affrc.go.jp
Phone:	81-29-838-6437
Keywords:	fruit drop

Publications


Year	Publication
2002	Yamamoto T, Kimura T, Shoda M, Imai T, Saito T, Sawamura Y, Kotobuki K, Hayashi T, Matsuta N. Genetic linkage maps constructed by using an interspecific cross between Japanese and European pears. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2002 Dec; 106(1):9-18.
2014	Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Pear-PM-F1-Moonglow	13	N/A	56.61	NH021a	View
2	Pear-La_France-F1-2007	La13	N/A	77.4	NH021a	View
3	Pear-Ba-F1-2013	Ba13	N/A	49.8	NH021a-1	View
4	Pear-integrated_consensus_map-IPCG-2017	LG13	N/A	142.61	NH021a	View
5	Pear-Rcf-F1-female	LG13	N/A	6.93	NH021a	View
6	Pear-M-F1-male	LG13	N/A	3.91	NH021a	View
7	Pear-RM-F1-Integrated	LG13	N/A	5.42	NH021a	View