TsuENH086, TsuENH086 (genetic_marker) Pyrus pyrifolia

Marker Overview
NameTsuENH086
Genbank IDN/A
TypeSSR
SpeciesPyrus pyrifolia
Primer 1TsuENH086.forward primer: ctctgttctgcttcgattctgct
Primer 2TsuENH086.reverse primer: gtccacgttcaccatttttcagt
Product Length172
Max Length183 bp
Publication[view all]
ContactShingo Terakami
Contact
NameDetails
Shingo Terakami
First name:Shingo
Last name:Terakami
Institution:NARO Institute of Fruit Tree Science
Address:NARO Institute of Fruit Tree Science, Tsukuba, Japan
Country:Japan
Email:terakami@affrc.go.jp
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerTsuENH086.forward primerPyrus pyrifoliaprimer
reverse primerTsuENH086.reverse primerPyrus pyrifoliaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TsuENH086TsuENH086Pyrus pyrifoliamarker_locus
TsuENH086TsuENH086-57.86Pyrus pyrifoliamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pear-PM-F1-Moonglow5N/A22.71TsuENH086View
2Pear-BD-F1-2014-geneticLG5N/A118.9TsuENH086View
3Pear-integrated_consensus_map-IPCG-2017LG5N/A57.86TsuENH086View