|
|
Marker Overview
| Name | NH004a |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Pyrus pyrifolia |
|---|
| Repeat Motif | (GA)19 |
|---|
| PCR Condition | 50 |
|---|
| Primer 1 | NH004a.forward primer: AGGATGGGACGAGTTTAGAG |
|---|
| Primer 2 | NH004a.reverse primer: CCACATCTCTCAACCTACCA |
|---|
| Product Length | 113 |
|---|
| Max Length | 93 bp |
|---|
| Publication | [view all] |
|---|
| Contact | Toshiya Yamamoto
Miyuki Kunihisa
|
|---|
Publications
| Year | Publication |
|---|
| 2002 | Yamamoto T, Kimura T, Shoda M, Ban Y, Hayashi T, Matsuta N. Development of microsatellite markers in the Japanese pear (Pyrus pyrifolia Nakai). Molecular Ecology Notes. 2002 Mar; 2(1):14-16. |
| 2009 | Celton J-M, Tustin DS, Chagne D, Gardiner SE. Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009; 5(1):93-107. |
| 2014 | Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51. |
|
