|
Marker Overview
Name | NZmsEB119405 |
Genbank ID | N/A |
Type | SSR |
Species | Malus x domestica |
Repeat Motif | (CGT)6 |
Primer 1 | NZmsEB119405.F: GCATGTCAAACCACTTGTCC |
Primer 2 | NZmsEB119405.R: ATTCTCTCGCGGCAGTT |
Publication | [view all] |
Contact | S. Gardiner
|
Publications
Year | Publication |
2012 | Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203. |
2009 | Celton J-M, Tustin DS, Chagne D, Gardiner SE. Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009; 5(1):93-107. |
|