SAmsCN917681, SAmsCN917681 (genetic_marker) Malus x domestica | GDR

Marker Overview

Marker Overview


Name	SAmsCN917681
Genbank ID	N/A
Type	SSR
Species	Malus x domestica
Repeat Motif	(TTC) 12
Primer 1	SAmsCN917681.Forward Primer: CTCCATTTACAACCAAAGGG
Primer 2	SAmsCN917681.Reverse Primer: TCCGTGGCAGACTTTTCGG
Max Length	434
Publication	[view all]
Contact	Felicidad Fernandez-Fernandez

Contact

Name

Details

Felicidad Fernandez-Fernandez

First name:	Felicidad
Last name:	Fernandez-Fernandez
Title:	Researcher
Institution:	East Malling Research
Address:	East Malling Research (EMR), New Road, East Malling, Kent ME19 6BJ, UK
Country:	United Kingdoms
Email:	felicidad.fernandez@emr.ac.uk
Fax:	+44 1732 849067
Last update:	Mar 2006

Publications


Year	Publication
2012	Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2012	Fernández-Fernández F, Antanaviciute L, van Dyk MM, Tobutt KR, Evans KM, Rees DJG, Dunwell JM, Sargent DJ. A genetic linkage map of an apple rootstock progeny anchored to the Malus genome sequence. Tree genetics & genomes. 2012; 8(5):991-1002.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Apple-MM-F1	5	N/A	50.5	SAmsCN917681	View
2	Apple-M432-2012	LG5	N/A	45.1	SAmsCN917681	View
3	Apple-M27xM116-2016	LG5	N/A	50.4	SAmsCN917681	View

Alignments

Feature Name	Type	Location	Analysis
chr5A	chromosome	chr5A:23563638..23564035.	Malus x domestica ‘Honeycrisp’ Genome v1.1.a1 Assembly & Annotation