NZmsCN898349, NZmsCN898349 (genetic_marker) Malus x domestica

Marker Overview
NameNZmsCN898349
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat Motif(TC)19+(TTC)6
Primer 1NZmsCN898349.F: GAGTTGGCAGAAAGAAACCA
Primer 2NZmsCN898349.R: CTGGGTGAAGACGAGATGCT
Publication[view all]
ContactS. Gardiner
Contact
NameDetails
S. Gardiner
First name:Sue
Last name:Gardiner
Institution:HortResearch, New Zealand
Address:HortResearch Palmerston North Tennent Drive Private Bag 11 030 Palmerston North, New Zealand
Email:sgardiner@hortresearch.co.nz
Phone:64-6-356 8080
Relationships

This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fruit diameterqFRDIA.JGD-J5.2008Malus x domesticaQTL


This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
FNZmsCN898349.FMalus x domesticaprimer
RNZmsCN898349.RMalus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NZmsCN898349NZmsCN898349Malus x domesticamarker_locus
NZmsCN898349NZmsCN898349-36.6Malus x domesticamarker_locus
NZmsCN898349NZmsCN898349-78.47Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-MM-F15N/A58.5NZmsCN898349View
2Apple-GDxJ-F1-2012LG5N/A93.6NZmsCN898349View
3Apple-M432-2012LG5N/A54.7NZmsCN898349View
4Apple-JGD-F1-2014J5N/A88NZmsCN898349View
5Apple-M27xM116-2016LG5N/A58.1NZmsCN898349View
6Pear-Ba-F1-2013Ba5N/A36.6NZmsCN898349View
7Pear-integrated_consensus_map-IPCG-2017LG5N/A78.47NZmsCN898349View