CV085249, CV085249 (genetic_marker) Malus x domestica | GDR

Marker Overview

Marker Overview


Name	CV085249
Genbank ID	N/A
Type	SSR
Species	Malus x domestica
Repeat Motif	(CAA)8
Primer 1	CV085249.forward primer: AAAAGACAACGCAAACCCTG
Primer 2	CV085249.reverse primer: CTTGTCTTCTTCAGGGCCAG
Max Length	300
Publication	[view all]
Contact	Felicidad Fernandez-Fernandez Schuyler Korban

Contact

Name

Details

Felicidad Fernandez-Fernandez

First name:	Felicidad
Last name:	Fernandez-Fernandez
Title:	Researcher
Institution:	East Malling Research
Address:	East Malling Research (EMR), New Road, East Malling, Kent ME19 6BJ, UK
Country:	United Kingdoms
Email:	felicidad.fernandez@emr.ac.uk
Fax:	+44 1732 849067
Last update:	Mar 2006

Schuyler Korban

First name:	Schuyler
Last name:	Korban
Title:	Researcher
Institution:	University of Illinois
Address:	Urbana, IL 61801, USA
Country:	USA
Email:	korban@illinois.edu

Publications


Year	Publication
2012	Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2012	Fernández-Fernández F, Antanaviciute L, van Dyk MM, Tobutt KR, Evans KM, Rees DJG, Dunwell JM, Sargent DJ. A genetic linkage map of an apple rootstock progeny anchored to the Malus genome sequence. Tree genetics & genomes. 2012; 8(5):991-1002.
2009	Gasic K, Han Y, Kertbundit S, Shulaev V, Iezzoni AF, Stover EW, Bell RL, Wisniewski ME, Korban SS. Characteristics and transferability of new apple EST-derived SSRs to other Rosaceae species. Molecular Breeding. 2009; 23(3):397-411.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Apple-MM-F1	10	N/A	85.1	CV085249.y	View
2	Apple-M432-2012	LG10	N/A	84.3	CV085249.y	View
3	Apple-M432-2012	LG4	N/A	19.2	CV085249.z	View
4	Apple-M432-2012	LG16	N/A	55	CV085249.x	View