|
|
Marker Overview
| Name | NZmsDR033893 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Malus x domestica |
|---|
| Repeat Motif | (AGT)6 |
|---|
| Primer 1 | NZmsDR033893.F: CACTTAGGGTGTATGGGTGTGA |
|---|
| Primer 2 | NZmsDR033893.R: TCATTTTGGGCAGGCACT |
|---|
| Publication | [view all] |
|---|
| Contact | S. Gardiner
|
|---|
Publications
| Year | Publication |
|---|
| 2012 | Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203. |
| 2009 | Celton J-M, Tustin DS, Chagne D, Gardiner SE. Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009; 5(1):93-107. |
|
