NZmsDR999337, NZmsDR999337 (genetic_marker) Malus x domestica

Marker Overview
NameNZmsDR999337
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat Motif(GAA)5(GAT)6
Primer 1NZmsDR999337.F: ACAGATTGGGATCTCGTGCT
Primer 2NZmsDR999337.R: CTTAGCCTGTGTTGCACATTG
Publication[view all]
ContactFelicidad Fernandez-Fernandez
S. Gardiner
Contact
NameDetails
Felicidad Fernandez-Fernandez
First name:Felicidad
Last name:Fernandez-Fernandez
Title:Researcher
Institution:East Malling Research
Address:East Malling Research (EMR), New Road, East Malling, Kent ME19 6BJ, UK
Country:United Kingdoms
Email:felicidad.fernandez@emr.ac.uk
Fax:+44 1732 849067
Last update:Mar 2006
S. Gardiner
First name:Sue
Last name:Gardiner
Institution:HortResearch, New Zealand
Address:HortResearch Palmerston North Tennent Drive Private Bag 11 030 Palmerston North, New Zealand
Email:sgardiner@hortresearch.co.nz
Phone:64-6-356 8080
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
FNZmsDR999337.FMalus x domesticaprimer
RNZmsDR999337.RMalus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NZmsDR999337.xNZmsDR999337.xMalus x domesticamarker_locus
NZmsDR999337.yNZmsDR999337.yMalus x domesticamarker_locus
NZmsDR999337NZmsDR999337-36.3Malus x domesticamarker_locus
NZmsDR999337NZmsDR999337-51.28Malus x domesticamarker_locus
NZmsDR999337NZmsDR999337-156.49Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-MM-F112N/A35.1NZmsDR999337.xView
2Apple-M432-2012LG12N/A37.9NZmsDR999337.xView
3Apple-M432-2012LG12N/A39.1NZmsDR999337.yView
4Pear-Ba-F1-2013Ba4N/A36.3NZmsDR999337View
5Pear-integrated_consensus_map-IPCG-2017LG4N/A51.28NZmsDR999337View
6Pear-integrated_consensus_map-IPCG-2017LG12N/A156.49NZmsDR999337View