EMPc115, EMPc115 (genetic_marker) Pyrus communis | GDR

Marker Overview

Marker Overview


Name	EMPc115
Genbank ID	AM182396
Type	SSR
Species	Pyrus communis
Repeat Motif	(GT)14
Primer 1	EMPc115.F: AGAAGCGAGGAAGCAGTGTAT
Primer 2	EMPc115.R: CATGTAGACCAGTTTCATTTGC
Max Length	212
Publication	[view all]
Contact	Miyuki Kunihisa Felicidad Fernandez-Fernandez

Contact

Name

Details

Miyuki Kunihisa

First name:	Miyuki
Last name:	Kunihisa
Institution:	NARO Institute of Fruit Tree Science
Address:	2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:	Japan
Email:	miyuky@affrc.go.jp
Phone:	81-29-838-6437
Keywords:	fruit drop

Felicidad Fernandez-Fernandez

First name:	Felicidad
Last name:	Fernandez-Fernandez
Title:	Researcher
Institution:	East Malling Research
Address:	East Malling Research (EMR), New Road, East Malling, Kent ME19 6BJ, UK
Country:	United Kingdoms
Email:	felicidad.fernandez@emr.ac.uk
Fax:	+44 1732 849067
Last update:	Mar 2006

Publications


Year	Publication
2014	Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.
2006	Fernández-Fernández F, Harvey NG. James CM. Isolation and characterization of polymorphic microsatellite markers from European pear (Pyrus communis L.). Mol. Ecol. Notes. 2006. 6: 1039–1041.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Apple-OA-F1-Orin	OR9	N/A	65.9	EMPc115	View
2	Apple-OA-F1-Akane	AK9	N/A	69.4	EMPc115	View
3	Pear-Ba-F1-2013	Ba10	N/A	4.9	EMPc115	View
4	Pear-BD-F1-2015	LG10	N/A	46.9	EMPc115	View
5	Pear-Bayuehong-F1-2015	LG10	N/A	47.74	EMPc115	View
6	Pear-Dangshansuli-F1-2015	LG10	N/A	59.67	EMPc115	View
7	Pear-integrated_consensus_map-IPCG-2017	LG10	N/A	93.91	EMPc115	View