|
|
Marker Overview
| Name | HGA8b |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Pyrus sp. |
|---|
| PCR Condition | annealing temp 55 degree |
|---|
| Primer 1 | HGA8b.primer 1: AACAAGCAAAGGCAGAACAA |
|---|
| Primer 2 | HGA8b.primer 2: CATAGAGAAAGCAAAGCAAA |
|---|
| Product Length | 133-164 |
|---|
| Publication | [view all] |
|---|
| Contact | Miyuki Kunihisa
T. Yamamoto
|
|---|
Publications
| Year | Publication |
|---|
| 2014 | Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51. |
| 2002 | Yamamoto T, Kimura T, Sawamura Y, Manabe T, Kotobuki K, Hayashi T, Ban Y, Matsuta N. Simple sequence repeats for genetic analysis in pear. Euphytica. 2002; 124:129-137. |
| 2012 | Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203. |
| 2004 | Yamamoto T, Kimura T, Saito T, Kotobuki K, Matsuta N, Liebhard R, Gessler C, Weg W.E. van de, Hayashi, T. Genetic linkage maps of Japanese and European pears aligned to the apple consensus map. Acta Horticulturae. 2004; 663:51-56. |
|
