KA4b, KA4b (genetic_marker) Pyrus sp.

Marker Overview
NameKA4b
Genbank IDN/A
TypeSSR
SpeciesPyrus sp.
PCR Conditionannealing temp 55 degree
Primer 1KA4b.forward: CAC GAC GTT GTA AAA CGA CAAA GGT CTC TCT CAC TGT CT
Primer 2KA4b.primer 1: AAAGGTCTCTCTCACTGTCT
Primer 3KA4b.primer 2: CCTCAGCCCAACTCAAAGCC
Primer 4KA4b.reverse: CCT CAG CCC AAC TCA AAG CC
Product Length137-141
PolymorphismP_ KA4b
Publication[view all]
ContactMiyuki Kunihisa
T. Yamamoto
CommentGenomic DNA was extracted from leaf tissue using Qiagen DNeasy 96 plant kits (QIAGEN GmbH, Hilden Germany). Sixteen SSR primers were selected for amplification based on previously published studies (Table 2; Liebhard et al. 2002; Yamamoto et al. 2002). The M13 primer, 5’ CACGACGTTGTAAAACGA 3’, with fluorescent dye label (6FAM, or VIC, or NED) was covalently bound to the 5’ end for detection on the ABI 3730 was synthetized from Applied Biosystems (Carlsbad, CA). The two unlabeled primers consisted of a specific SSR-targeting forward primer with a 5’ M13 tail and a specific SSR-targeting reverse primer was synthetized from Sangon Biotech (Shanghai, China). Amplification was carried out in two PCR cycles. The first PCR amplification was performed in a 10μl solution of 20 ng genomic DNA, 1×PCR buffer, 0.25 mM dNTP, 0.6 unit Taq DNA polymerase, 2 mM MgCl2, 0.24μM reverse primer, 0.24 μM forward primer with M13 tail. The first PCR amplification was performed under the following conditions: 94℃ (5 min), 35 cycles at 94℃(30 s)/annealing temperature (An.T) (30 s)/72℃ (45 s), and a final extension at 72℃ for 10 min. using the optimal annealing temperature for each locus (Table 2). The second amplification reaction was performed in a 12.1μl solution of 10μl PCR products of the first PCR circle, 0.3μM fluorescent labeled M13 primer, 0.1× supplied PCR buffer, 0.4 unit of Taq DNA polymerase. The conditions of the second PCR amplification were as follows: 94℃ (5 min), 16 cycles at 94℃ (30 s)/53℃(45 s)/72℃ (45 s), and a final extension at 72℃for10 min. The PCR products were cleaned with ethanol, and then denaturated at 94℃ for 5 min. Finally the fluorescent labeled PCR products at each locus were separated using an ABI 3730 DNA Analyzer (Applied Biosystems, Carlsbad, CA).
Publications
YearPublication
2014Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.
2002Yamamoto T, Kimura T, Sawamura Y, Manabe T, Kotobuki K, Hayashi T, Ban Y, Matsuta N. Simple sequence repeats for genetic analysis in pear. Euphytica. 2002; 124:129-137.
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2015Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2004Plant Breeding, 123(4):321
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2009Celton J-M, Tustin DS, Chagne D, Gardiner SE. Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009; 5(1):93-107.
2004Yamamoto T, Kimura T, Saito T, Kotobuki K, Matsuta N, Liebhard R, Gessler C, Weg W.E. van de, Hayashi, T. Genetic linkage maps of Japanese and European pears aligned to the apple consensus map. Acta Horticulturae. 2004; 663:51-56.
2015Luigi Falginella, Guido Cipriani, Corinne Monte, Roberto Gregori, Raffaele Testolin, Riccardo Velasco, Michela Troggio, Stefano Tartarini. A major QTL controlling apple skin russeting maps on the linkage group 12 of ‘Renetta Grigia di Torriana’. BMC Plant Biology. 2015; 15:150.
Contact
NameDetails
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
T. Yamamoto
First name:Toshiya
Last name:Yamamoto
Title:researcher
Institution:National Institute of Fruit Tree Science, Japan
Address:National Institute of Fruit Tree Science Fujimoto 2-1, Tsukuba Ibaraki 305-8605, Japan
Email:toshiya@affrc.go.jp
Phone:81-29-838-6474,6491
Keywords:Pyrus pyrifolia
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forwardKA4b.forwardPyrus sp.primer
reverseKA4b.reversePyrus sp.primer
primer 1KA4b.primer 1Pyrus sp.primer
primer 2KA4b.primer 2Pyrus sp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
KA4bKA4bPyrus sp.marker_locus
KA4bKA4b-44.1Pyrus sp.marker_locus
KA4bKA4bMalus x domesticamarker_locus
KA4bKA4b-48.7Pyrus sp.marker_locus
KA4bKA4b-102.86Pyrus sp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-OA-F1-AkaneAK1N/A29.2KA4bView
2Apple-X3259X3263-F11N/A36.88KA4bView
3Apple-GDxJ-F1-2012LG1N/A78.1KA4bView
4Apple-MM-F11N/A37.6KA4bView
5Apple Integrated map1N/A53.5KA4bView
6Pear-BH-F1Ho1-2N/A0KA4bView
7Apple-M432-2012LG1N/A41.8KA4bView
8Apple-X5210X8402-F1-X5210LG13N/A85.1KA4bView
9Pear-BD-F1-2014-geneticLG1N/A88.6KA4bView
10Pear-Bartlett-F1-2007Ba1N/A59.3KA4bView
11Apple-JM7xS63-F1J1N/A44.1KA4bView
12Apple-RGTxGD-F1-2015RGT_1N/A36.48KA4bView
13Apple-RGTxGD-F1-2015GD_1N/A40.43KA4bView
14Apple-RGxPI6-F1LG1N/A60.8KA4bView
15Pear-Ba-F1-2013Ba1N/A48.7KA4bView
16Pear-integrated_consensus_map-IPCG-2017LG1N/A102.86KA4bView