|
Marker Overview
Name | KA4b |
Genbank ID | N/A |
Type | SSR |
Species | Pyrus sp. |
PCR Condition | annealing temp 55 degree |
Primer 1 | KA4b.forward: CAC GAC GTT GTA AAA CGA CAAA GGT CTC TCT CAC TGT CT |
Primer 2 | KA4b.primer 1: AAAGGTCTCTCTCACTGTCT |
Primer 3 | KA4b.primer 2: CCTCAGCCCAACTCAAAGCC |
Primer 4 | KA4b.reverse: CCT CAG CCC AAC TCA AAG CC |
Product Length | 137-141 |
Polymorphism | P_ KA4b |
Publication | [view all] |
Contact | Miyuki Kunihisa T. Yamamoto
|
Comment | Genomic DNA was extracted from leaf tissue using Qiagen DNeasy 96 plant kits (QIAGEN GmbH, Hilden Germany). Sixteen SSR primers were selected for amplification based on previously published studies (Table 2; Liebhard et al. 2002; Yamamoto et al. 2002). The M13 primer, 5’ CACGACGTTGTAAAACGA 3’, with fluorescent dye label (6FAM, or VIC, or NED) was covalently bound to the 5’ end for detection on the ABI 3730 was synthetized from Applied Biosystems (Carlsbad, CA). The two unlabeled primers consisted of a specific SSR-targeting forward primer with a 5’ M13 tail and a specific SSR-targeting reverse primer was synthetized from Sangon Biotech (Shanghai, China). Amplification was carried out in two PCR cycles. The first PCR amplification was performed in a 10μl solution of 20 ng genomic DNA, 1×PCR buffer, 0.25 mM dNTP, 0.6 unit Taq DNA polymerase, 2 mM MgCl2, 0.24μM reverse primer, 0.24 μM forward primer with M13 tail. The first PCR amplification was performed under the following conditions: 94℃ (5 min), 35 cycles at 94℃(30 s)/annealing temperature (An.T) (30 s)/72℃ (45 s), and a final extension at 72℃ for 10 min. using the optimal annealing temperature for each locus (Table 2). The second amplification reaction was performed in a 12.1μl solution of 10μl PCR products of the first PCR circle, 0.3μM fluorescent labeled M13 primer, 0.1× supplied PCR buffer, 0.4 unit of Taq DNA polymerase. The conditions of the second PCR amplification were as follows: 94℃ (5 min), 16 cycles at 94℃ (30 s)/53℃(45 s)/72℃ (45 s), and a final extension at 72℃for10 min. The PCR products were cleaned with ethanol, and then denaturated at 94℃ for 5 min. Finally the fluorescent labeled PCR products at each locus were separated using an ABI 3730 DNA Analyzer (Applied Biosystems, Carlsbad, CA). |
Publications
Year | Publication |
2014 | Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51. |
2002 | Yamamoto T, Kimura T, Sawamura Y, Manabe T, Kotobuki K, Hayashi T, Ban Y, Matsuta N. Simple sequence repeats for genetic analysis in pear. Euphytica. 2002; 124:129-137. |
2010 | Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839. |
2012 | Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203. |
2015 | Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119 |
2002 | Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241. |
2004 | Plant Breeding, 123(4):321 |
2006 | Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224. |
2009 | Celton J-M, Tustin DS, Chagne D, Gardiner SE. Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009; 5(1):93-107. |
2004 | Yamamoto T, Kimura T, Saito T, Kotobuki K, Matsuta N, Liebhard R, Gessler C, Weg W.E. van de, Hayashi, T. Genetic linkage maps of Japanese and European pears aligned to the apple consensus map. Acta Horticulturae. 2004; 663:51-56. |
2015 | Luigi Falginella, Guido Cipriani, Corinne Monte, Roberto Gregori, Raffaele Testolin, Riccardo Velasco, Michela Troggio, Stefano Tartarini. A major QTL controlling apple skin
russeting maps on the linkage group 12
of ‘Renetta Grigia di Torriana’. BMC Plant Biology. 2015; 15:150. |
|