|
Marker Overview
Name | NH011b |
Genbank ID | N/A |
Type | SSR |
Species | Pyrus pyrifolia |
Repeat Motif | (AG)9AA(AG)7 |
PCR Condition | 55 |
Primer 1 | NH011b.forward primer: GGTTCACATAGAGAGAGAGAG |
Primer 2 | NH011b.reverse primer: TTTGCCGTTGGACCGAGC |
Product Length | 181 |
Publication | [view all] |
Contact | Miyuki Kunihisa Toshiya Yamamoto
|
Publications
Year | Publication |
2014 | Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51. |
2002 | Yamamoto T, Kimura T, Shoda M, Ban Y, Hayashi T, Matsuta N. Development of microsatellite markers in the Japanese pear (Pyrus pyrifolia Nakai). Molecular Ecology Notes. 2002 Mar; 2(1):14-16. |
|