TsuENH094, TsuENH094 (genetic_marker) Pyrus pyrifolia | GDR

Marker Overview

Marker Overview


Name	TsuENH094
Genbank ID	N/A
Type	SSR
Species	Pyrus pyrifolia
Primer 1	TsuENH094.forward primer: gcccgaatagtcccacaacc
Primer 2	TsuENH094.reverse primer: ttcctcatccgtgccactattta
Publication	[view all]
Contact	Miyuki Kunihisa Shingo Terakami

Contact

Name

Details

Miyuki Kunihisa

First name:	Miyuki
Last name:	Kunihisa
Institution:	NARO Institute of Fruit Tree Science
Address:	2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:	Japan
Email:	miyuky@affrc.go.jp
Phone:	81-29-838-6437
Keywords:	fruit drop

Shingo Terakami

First name:	Shingo
Last name:	Terakami
Institution:	NARO Institute of Fruit Tree Science
Address:	NARO Institute of Fruit Tree Science, Tsukuba, Japan
Country:	Japan
Email:	terakami@affrc.go.jp

Publications


Year	Publication
2014	Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.
2009	Terakami S, Kimura T, Nishitani C, Sawamura Y, Saito T, Hirabayashi T, Yamamoto T. Genetic Linkage Map of the Japanese Pear ‘Housui’ Identifying Three Homozygous Genomic Regions. 2009 J. Japan. Soc. Hort. Sci. 78 (4): 417–424.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Apple-OA-F1-Orin	OR1	N/A	71.5	TsuENH094	View
2	Pear-integrated_consensus_map-IPCG-2017	LG7	N/A	90.28	TsuENH094	View