CTG016593.293, CTG016593.293 (genetic_marker) Malus x domestica

Marker Overview
NameCTG016593.293
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat Motif(CT)20
Primer 1CTG016593.293.forward: TAATCCACATTCTGGCAACG
Primer 2CTG016593.293.reverse: GTATAAGTTCCATCCGCCCA
Publication[view all]
ContactZhen Han
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forwardCTG016593.293.forwardMalus x domesticaprimer
reverseCTG016593.293.reverseMalus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CTG016593.293CTG016593.293Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-JGD-F1-FRRG14N/A74.3CTG016593.293View
Contact
NameDetails
Zhen Han
First name:Zhen
Last name:Han
Institution:Institute for Horticultural Plants, China Agricultural University
Address:Beijing 100193, China
Country:China
Email:rschan@cau.edu.cn
Keywords:apple