WBGCAS65, WBGCAS65 (genetic_marker) Malus x domestica

Marker Overview
NameWBGCAS65
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Primer 1WBGCAS65.forward primer: CCCTTGTCCCTGGCTTCTTC
Primer 2WBGCAS65.reverse primer: TGTGTAAGTAGTGCTCGGAGTG
Publication[view all]
ContactZhen Han
Xin Zhang
Yuepeng Han
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerWBGCAS65.forward primerMalus x domesticaprimer
reverse primerWBGCAS65.reverse primerMalus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
WBGCAS65WBGCAS65Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-JGD-F1-BotcankerJ10N/A21.2WBGCAS65View
2Apple-GDxJ-F1-2012LG10N/A36.2WBGCAS65View
Contact
NameDetails
Zhen Han
First name:Zhen
Last name:Han
Institution:Institute for Horticultural Plants, China Agricultural University
Address:Beijing 100193, China
Country:China
Email:rschan@cau.edu.cn
Keywords:apple
Xin Zhang
First name:Xin
Last name:Zhang
Institution:Institute for Horticultural Plants, China Agricultural University
Address:Beijing 100193, China
Country:China
Email:d zhangxinzhong999@126.com
Yuepeng Han
First name:Yuepeng
Last name:Han
Title:Researcher
Institution:Chinese Academy of Sciences
Address:Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture, Wuhan Botanical Garden, the Chinese Academy of Sciences, Wuhan 430074, People’s Republic of China
Country:China
Email:yphan@wbgcas.cn