isGH17-101, isGH17-101 (genetic_marker) Prunus avium

Marker Overview
NameGH17-101
Genbank IDN/A
SNP Array ID
Cherry 6+9K SNP array:GH17-101
Typecandidate gene marker
5' Flanking SequenceACAATTTCCAAAGACCCTCCGCCCGCCTTCTCAAGAGCGGCATAAACAGC
3' Flanking SequenceTCCAAAATGGCATCGAAAAGATTACGATAGCCACGTTGGCCATCTTGTAC
SpeciesPrunus avium
Primer 1isGH17-101.Forward: GAGGCACACTTGCAATACTTCTT
Primer 2isGH17-101.Reverse: TAGGTTTCTATGGCCCTTCC
Publication[view all]
ContactStijn Vanderzande
Commentpeach homologue was located on the peach genome sequence and then located into the sweet cherry map using flanking markers
Contact
NameDetails
Stijn Vanderzande
First name:Stijn
Last name:Vanderzande
Address:Laboratory for Fruit Breeding and Biotechnology - Willem de Croylaan 42 - B-3001 Heverlee - Belgium
Country:Belgium
Email:stijn.vanderzande@wsu.edu
Libraries
Library NameType
Cherry 6+9K SNP arraySNP_chip
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardisGH17-101.ForwardPrunus aviumprimer
ReverseisGH17-101.ReversePrunus aviumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
GH17-101GH17-101Prunus aviummarker_locus


Sequence
>GH17-101 ID=GH17-101|Name=GH17-101|organism=Prunus avium|type=genetic_marker|length=101bp
ACAATTTCCAAAGACCCTCCGCCCGCCTTCTCAAGAGCGGCATAAACAGC
RTCCAAAATGGCATCGAAAAGATTACGATAGCCACGTTGGCCATCTTGTA
C
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Sweet Cherry-RG-F1-2015R7N/A5.06GH17-101View
Alignments
Feature NameTypeLocationAnalysis
Pp07 chromosome Pp07:8969524..8969523. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)