PavMBF1C, PavMBF1C (genetic_marker) Prunus avium

Marker Overview
NameMBF1C
dbSNP IDN/A
SNP Array ID
Cherry 6+9K SNP array:MBF1C
TypeSNP
SNP AllelesA/G
5' Flanking SequenceGAAGAAGCTCGAGGAAGGGACCGAGCCGGCCGCGCTGGACCGGGTCTCGA
3' Flanking SequenceCGATGTGAGGCAGGCCATACAGAAGGCTCGTCTGGCGAAGAAGTTGAGCC
SpeciesPrunus avium
Publication[view all]
ContactStijn Vanderzande
Comment'Regina' [A/G] 'Lapins' [G/G] 'Garnet' [G/G]
Contact
NameDetails
Stijn Vanderzande
First name:Stijn
Last name:Vanderzande
Address:Laboratory for Fruit Breeding and Biotechnology - Willem de Croylaan 42 - B-3001 Heverlee - Belgium
Country:Belgium
Email:stijn.vanderzande@wsu.edu
Libraries
Library NameType
Cherry 6+9K SNP arraySNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MBF1CMBF1CPrunus aviummarker_locus


Sequence
>MBF1C ID=MBF1C|Name=MBF1C|organism=Prunus avium|type=genetic_marker|length=101bp
GAAGAAGCTCGAGGAAGGGACCGAGCCGGCCGCGCTGGACCGGGTCTCGA
RCGATGTGAGGCAGGCCATACAGAAGGCTCGTCTGGCGAAGAAGTTGAGC
C
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Sweet Cherry-RG-F1-2015R7N/A56.24MBF1CView
2Sweet Cherry-RL-F1-2015R7N/A56.5MBF1CView
3Sweet Cherry-RosBREED-3.8K-20207N/A61.66MBF1CView
4Sweet Cherry-C-F1-6+9K_array7N/A67.86MBF1CView
5Sweet Cherry-VxC-F1-6+9K_array7N/A65.28MBF1CView
Alignments
Feature NameTypeLocationAnalysis
Pp07 chromosome Pp07:20188687..20188687. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
PAV_r1.0chr7 chromosome PAV_r1.0chr7:17610919..17610919. Prunus avium Whole Genome Assembly v1.0 & Annotation v1 (v1.0.a1)