PavNUA, PavNUA (genetic_marker) Prunus avium

Marker Overview
NameNUA
dbSNP IDN/A
SNP Array ID
Cherry 6+9K SNP array:NUA
TypeSNP
SNP AllelesT/C
5' Flanking SequenceAGTTTGATGGTTCAAATCAAGTAGAATCACAACCTGACAAGCATATTGGT
3' Flanking SequenceTAGAAGAAAATGTTGATGGATCAGGTGGAACTGAGATGATGTGTGATGAT
SpeciesPrunus avium
Publication[view all]
ContactStijn Vanderzande
Comment'Regina' [C/T] 'Lapins' [C/T] 'Garnet' [C/C]
Contact
NameDetails
Stijn Vanderzande
First name:Stijn
Last name:Vanderzande
Address:Laboratory for Fruit Breeding and Biotechnology - Willem de Croylaan 42 - B-3001 Heverlee - Belgium
Country:Belgium
Email:stijn.vanderzande@wsu.edu
Libraries
Library NameType
Cherry 6+9K SNP arraySNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NUANUAPrunus aviummarker_locus


Sequence
>NUA ID=NUA|Name=NUA|organism=Prunus avium|type=genetic_marker|length=101bp
AGTTTGATGGTTCAAATCAAGTAGAATCACAACCTGACAAGCATATTGGT
YTAGAAGAAAATGTTGATGGATCAGGTGGAACTGAGATGATGTGTGATGA
T
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Sweet Cherry-RG-F1-2015R4N/A15.98NUAView
2Sweet Cherry-RL-F1-2015R4N/A18.48NUAView
3Sweet Cherry-RL-F1-2015L4N/A21.84NUAView
4Sweet Cherry-RosBREED-3.8K-20204N/A26.18NUAView
5Sweet Cherry-C-F1-6+9K_array4N/A36.71NUAView
6Sweet Cherry-VxC-F1-6+9K_array4N/A31.85NUAView
Alignments
Feature NameTypeLocationAnalysis
Pp04 chromosome Pp04:6823591..6823591. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
PAV_r1.0chr4 chromosome PAV_r1.0chr4:8958502..8958502. Prunus avium Whole Genome Assembly v1.0 & Annotation v1 (v1.0.a1)