|
Publications
Year | Publication |
2016 | Mahoney LL, Sargent DJ, Abebe-Akele F, Wood DJ, Ward JA, Bassil NV, Hancock JF, Folta KM, & Davis TM. (2016). A High-Density Linkage Map of the Ancestral Diploid Strawberry, Fragaria iinumae, Constructed with Single Nucleotide Polymorphism Markers from the IStraw90 Array and Genotyping by Sequencing. The Plant Genome, 9(2), plantgenome2015.2008.0071. |
Sequence
>166_52041 ID=166_52041; Name=166_52041; organism=Fragaria iinumae; type=genetic_marker; length=64bp AAACAGAACCTATCTGCAATGCAGCATCAATTTTCCTGTTATATGGCATC AGAGMATATGCGGA
|