TP8025, TP8025 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP8025
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP8025TP8025Fragaria iinumaemarker_locus
TP8025TP8025-22.739Fragaria iinumaemarker_locus


Sequence
>TP8025 ID=TP8025|Name=TP8025|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGTAGGTCCTGTGAAGCAGGCTTTGATAGCCGAAACTAGAGTTTCCG
AGATCGGAAGAGCG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A22.74TP8025View
2Fragaria-Fii5N/A22.74TP8025-22.739View