TP463, TP463 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP463
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP463TP463Fragaria iinumaemarker_locus
TP463TP463-22.739Fragaria iinumaemarker_locus


Sequence
>TP463 ID=TP463|Name=TP463|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGAACTGATCAGTTGGATTTCAAGCTAGGCTAGGATTGATATGAGGA
ATTTCAGAGCATAC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A22.74TP463View
2Fragaria-Fii5N/A22.74TP463-22.739View